![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4526 |
|||||
Accession | MI0016893 (change log) | ||||
Symbol | HGNC:MIR4526 | ||||
Description | Homo sapiens miR-4526 stem-loop | ||||
Gene family | MIPF0001545; mir-4526 | ||||
Stem-loop |
u auc - c u u -- - g 5' gcggugac ag ggcc ag cccugcuguca gccc ca g u |||||||| || |||| || ||||||||||| |||| || | 3' ugucacug uc ccgg uc gggacgacagu cggg gu c g c caa g - - - uc g a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4526 |
|
Accession | MIMAT0019065 |
Sequence |
54 - gcugacagcagggcuggccgcu - 75 |
Deep sequencing | 81 reads, 35 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|