|
miRBase |
|
Stem-loop sequence hsa-mir-378i |
|||||
| Accession | MI0016902 | ||||
| Description | Homo sapiens miR-378i stem-loop | ||||
| Stem-loop |
g c ga a a ag - uu ugg ggagca ug cuagg guc ga gugg ag c g |||||| || ||||| ||| || |||| || | ucuugu ac ggucc cgg uu cacc uu g u g - -g - g cu c uu ucg |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-378i |
|
| Accession | MIMAT0019074 |
| Sequence |
7 - acuggacuaggagucagaagg - 27 |
| Deep sequencing | 320220 reads, 20 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|