Stem-loop sequence hsa-mir-4538

Accession

MI0016909 (change log)

Symbol

HGNC:MIR4538

Description

Homo sapiens miR-4538 stem-loop

Literature search

1 open access papers mention hsa-mir-4538
(3 sentences)

Stem-loop

   --g    ug   g  -    g  g    g    g    ga 
5'    agcu  gau ag cugg cu aacu ggcu gguu  g
      ||||  ||| || |||| || |||| |||| ||||   
3'    ucgg  cua uc gacc ga uuga ucgg ucgg  c
   gag    gu   g  a    -  g    g    g    gu 

Deep sequencing

102 reads, 2.78 reads per million, 36 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr14: 105858165-105858242 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000409220 ; PACS2-014; intron 1

  OTTHUMT00000409219 ; PACS2-013; intron 2

  OTTHUMT00000409217 ; PACS2-004; intron 6

  OTTHUMT00000409215 ; PACS2-005; intron 15

  OTTHUMT00000409211 ; PACS2-006; intron 20

  OTTHUMT00000409208 ; PACS2-002; intron 21

  OTTHUMT00000409209 ; PACS2-003; intron 21

  OTTHUMT00000409210 ; PACS2-001; intron 22

  ENST00000551801 ; PACS2-014; intron 1

  ENST00000548796 ; PACS2-013; intron 2

  ENST00000551743 ; PACS2-004; intron 6

  ENST00000551692 ; PACS2-005; intron 15

  ENST00000547217 ; PACS2-006; intron 20

  ENST00000430725 ; PACS2-002; intron 21

  ENST00000325438 ; PACS2-003; intron 21

  ENST00000447393 ; PACS2-201; intron 21

  ENST00000458164 ; PACS2-001; intron 22

Clustered miRNAs

< 10kb from hsa-mir-4538

• hsa-mir-4537: chr14: 105859484-105859553 [-]
• hsa-mir-4538: chr14: 105858165-105858242 [-]
• hsa-mir-4507: chr14: 105858124-105858175 [-]
• hsa-mir-4539: chr14: 105857513-105857572 [-]

Database links

• EntrezGene:MIR4538
• HGNC:MIR4538
• miRBase Tracker:MI0016909

Mature sequence hsa-miR-4538

• Accession: MIMAT0019081
• Sequence: 1 - gagcuuggaugagcugggcuga - 22
• Deep sequencing: 18 reads, 10 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4538
  • TargetScanVert:hsa-miR-4538
  • miRDB:hsa-miR-4538

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).