Stem-loop sequence pma-mir-128-2

AccessionMI0017061 (change log)
DescriptionPetromyzon marinus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   -   g    u a           caa     cc      u   ga 
5'  ggg ugcc g ggaggaggccg   cgcug  ugggag gau  g
    ||| |||| | |||||||||||   |||||  |||||| |||  c
3'  ccc acgg c cuuucucuggc   gugac  acucuc cug  c
   a   g    u c           caa     --      -   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL477033.1: 40713-40801 [+]
intergenic
Database links

Mature sequence pma-miR-128

Accession MIMAT0019449
Sequence

56 - 

ucacagugaaccggucucuuuc

 - 77

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).