Stem-loop sequence pma-let-7a-3

AccessionMI0017146 (change log)
DescriptionPetromyzon marinus let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
     g    a    gu                ----------     ag 
5' gc uggg ugag  aguagguuguauaguu          ugggg  u
   || |||| ||||  ||||||||||||||||          |||||  g
3' cg accc guuc  ucaucuaacaugucaa          gcccc  u
     a    -    ug                uagaggacuu     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL476357.1: 309640-309725 [-]
intergenic
Clustered miRNAs
< 10kb from pma-let-7a-3
pma-let-7a-3GL476357.1: 309640-309725 [-]
pma-let-7dGL476357.1: 302830-302915 [-]
Database links

Mature sequence pma-let-7a

Accession MIMAT0019564
Sequence

9 - 

ugagguaguagguuguauaguu

 - 30

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).