Stem-loop sequence pma-let-7a-4

AccessionMI0017147 (change log)
DescriptionPetromyzon marinus let-7a-4 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
      uu     u   g   u             uagcauuac 
5' guu  cgggg gag uag agguuguauaguu         a
   |||  ||||| ||| ||| |||||||||||||         c
3' cgg  gcccc uuc auc uccaacaugucaa         c
      gc     u   g   u             uagaggcau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-let-7a

Accession MIMAT0019564
Sequence

11 - 

ugagguaguagguuguauaguu

 - 32

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).