Stem-loop sequence osa-MIR3979

Accession

MI0017251 (change log)

Description

Oryza sativa miR3979 stem-loop

Literature search

10 open access papers mention osa-MIR3979
(15 sentences)

Stem-loop

        u     -a      u              a     ----ugg    -u     u 
5' gguuu cuugg  ucucuc cucccuugaaggcu ucuca       aggu  ugaug a
   ||||| |||||  |||||| |||||||||||||| |||||       ||||  ||||| c
3' ccgaa gaacc  agagag gagggggcuuccga agagu       uccg  guuac a
        c     ga      -              a     caaagaa    uu     c 

Deep sequencing

233 reads, 100 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr11: 19480150-19480263 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0017251

Mature sequence osa-miR3979-5p

• Accession: MIMAT0019673
• Sequence: 13 - ucucucucucccuugaaggc - 32
• Deep sequencing: 81 reads, 2 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS00005BF7E7_39947

Mature sequence osa-miR3979-3p

• Accession: MIMAT0019674
• Sequence: 85 - cuucgggggaggagagaagc - 104
• Deep sequencing: 152 reads, 2 experiments
• Evidence: experimental; Illumina [1-3]
• Database links:
  • RNAcentral:URS000030017C_39947

References

1. PMID:21113019 "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)" Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).
2. PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).
3. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).