![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR3979 |
|||||
Accession | MI0017251 (change log) | ||||
Description | Oryza sativa miR3979 stem-loop | ||||
Literature search |
![]()
10 open access papers mention osa-MIR3979 | ||||
Stem-loop |
u -a u a ----ugg -u u 5' gguuu cuugg ucucuc cucccuugaaggcu ucuca aggu ugaug a ||||| ||||| |||||| |||||||||||||| ||||| |||| ||||| c 3' ccgaa gaacc agagag gagggggcuuccga agagu uccg guuac a c ga - a caaagaa uu c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR3979-5p |
|
Accession | MIMAT0019673 |
Sequence |
13 - ucucucucucccuugaaggc - 32 |
Deep sequencing | 81 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Mature sequence osa-miR3979-3p |
|
Accession | MIMAT0019674 |
Sequence |
85 - cuucgggggaggagagaagc - 104 |
Deep sequencing | 152 reads, 2 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
References |
|
1 |
PMID:21113019
"Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)"
Nucleic Acids Res. 39:2821-2833(2011).
|
2 |
PMID:21791435
"Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)"
J Exp Bot. 62:4943-4954(2011).
|
3 |
PMID:22158467
"Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"
Plant Cell. 23:4185-4207(2011).
|