![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4638 |
|||||
Accession | MI0017265 (change log) | ||||
Symbol | HGNC:MIR4638 | ||||
Description | Homo sapiens miR-4638 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4638 | ||||
Stem-loop |
-g - acaa uc -c 5' gacuc gcugcggu gg g cgg uccaga ||||| |||||||| || | ||| ||||| a 3' cuggg cggcgccg cc c gcc aggucc ga g --ga uc ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4638-5p |
|
Accession | MIMAT0019695 |
Sequence |
2 - acucggcugcgguggacaagu - 22 |
Deep sequencing | 45 reads, 25 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4638-3p |
|
Accession | MIMAT0019696 |
Sequence |
35 - ccuggacaccgcucagccggccg - 57 |
Deep sequencing | 119 reads, 43 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|