![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4640 |
|||||
Accession | MI0017267 (change log) | ||||
Symbol | HGNC:MIR4640 | ||||
Description | Homo sapiens miR-4640 stem-loop | ||||
Literature search |
3 open access papers mention hsa-mir-4640 | ||||
Stem-loop |
cugugggc cu agua a g 5' ugggccagggagcag gguggguggga ag ucu a ||||||||||||||| ||||||||||| || ||| c 3' acccgguccuuuguc ccacccacccu uc agg c -----gac cc -acc - u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4640-5p |
|
Accession | MIMAT0019699 |
Sequence |
9 - ugggccagggagcagcugguggg - 31 |
Deep sequencing | 90 reads, 32 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4640-3p |
|
Accession | MIMAT0019700 |
Sequence |
67 - cacccccuguuuccuggcccac - 88 |
Deep sequencing | 44 reads, 24 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|