Stem-loop sequence hsa-mir-4640

Accession

MI0017267 (change log)

Symbol

HGNC:MIR4640

Description

Homo sapiens miR-4640 stem-loop

Literature search

3 open access papers mention hsa-mir-4640
(8 sentences)

Stem-loop

   cugugggc               cu           agua  a   g 
5'         ugggccagggagcag  gguggguggga    ag ucu a
           |||||||||||||||  |||||||||||    || ||| c
3'         acccgguccuuuguc  ccacccacccu    uc agg c
   -----gac               cc           -acc  -   u 

Deep sequencing

145 reads, 3.92 reads per million, 51 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr6: 30890883-30890972 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000257815 ; VARS2-011; exon 3

  OTTHUMT00000257808 ; VARS2-004; exon 12

  OTTHUMT00000257807 ; VARS2-003; exon 13

  OTTHUMT00000076566 ; VARS2-001; 3'UTR (exon 23)

  OTTHUMT00000076565 ; VARS2-002; exon 35

  ENST00000477052 ; VARS2-011; exon 3

  ENST00000476162 ; VARS2-004; exon 12

  ENST00000469358 ; VARS2-003; exon 13

  ENST00000321897 ; VARS2-001; 3'UTR (exon 23)

  ENST00000542001 ; VARS2-203; 3'UTR (exon 23)

  ENST00000541562 ; VARS2-202; 3'UTR (exon 24)

  ENST00000416670 ; VARS2-201; 3'UTR (exon 24)

  ENST00000477288 ; VARS2-002; exon 35

Database links

• EntrezGene:MIR4640
• HGNC:MIR4640
• miRBase Tracker:MI0017267

Mature sequence hsa-miR-4640-5p

• Accession: MIMAT0019699
• Sequence: 9 - ugggccagggagcagcugguggg - 31
• Deep sequencing: 90 reads, 32 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4640-5p
  • TargetScanVert:hsa-miR-4640-5p
  • miRDB:hsa-miR-4640-5p

Mature sequence hsa-miR-4640-3p

• Accession: MIMAT0019700
• Sequence: 67 - cacccccuguuuccuggcccac - 88
• Deep sequencing: 44 reads, 24 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4640-3p
  • TargetScanVert:hsa-miR-4640-3p
  • miRDB:hsa-miR-4640-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).