![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4642 |
|||||
Accession | MI0017269 (change log) | ||||
Symbol | HGNC:MIR4642 | ||||
Description | Homo sapiens miR-4642 stem-loop | ||||
Stem-loop |
a cc - -- cua 5' cacaacugc uggcaucguc cug guggcu guggc g ||||||||| |||||||||| ||| |||||| ||||| g 3' guguugacg accguaguag gac caccga caccg g - -u u aa aac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4642 |
|
Accession | MIMAT0019702 |
Sequence |
10 - auggcaucguccccugguggcu - 31 |
Deep sequencing | 20 reads, 15 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|