![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4648 |
|||||
Accession | MI0017275 (change log) | ||||
Symbol | HGNC:MIR4648 | ||||
Description | Homo sapiens miR-4648 stem-loop | ||||
Stem-loop |
----------------ugugggacugcaaa -a uca a 5' uggg gc gc c |||| || || 3' accc cg cg c gacacccuugucucguccccgaccagacgc ac -uc u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4648 |
|
Accession | MIMAT0019710 |
Sequence |
1 - ugugggacugcaaaugggag - 20 |
Deep sequencing | 15 reads, 11 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|