![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4654 |
|||||
Accession | MI0017282 (change log) | ||||
Symbol | HGNC:MIR4654 | ||||
Description | Homo sapiens miR-4654 stem-loop | ||||
Gene family | MIPF0001507; mir-4654 | ||||
Literature search |
3 open access papers mention hsa-mir-4654 | ||||
Stem-loop |
u -- u ucu auc gg 5' cuggc ggu ug ggga ggaggc ugggguu a ||||| ||| || |||| |||||| ||||||| a 3' gaccg cua ac cccu ccucug accccag u u cu u uuu --- ug |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4654 |
|
Accession | MIMAT0019720 |
Sequence |
10 - ugugggaucuggaggcaucugg - 31 |
Deep sequencing | 174 reads, 45 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|