Stem-loop sequence hsa-mir-4657

AccessionMI0017285 (change log)
Symbol HGNC:MIR4657
DescriptionHomo sapiens miR-4657 stem-loop
Gene family MIPF0002009; mir-4657
Stem-loop 
   a      a    g   ga          
5'  augugg agug ucu  ggcauauag 
    |||||| |||| |||  |||||||| a
3'  uauacc ucac aga  ccguauaug 
   -      a    a   -a
Get sequence
Deep sequencing
119 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 44881748-44881800 [-]
sense
OTTHUMT00000251306 ; H2AFV-003; intron 1
OTTHUMT00000376524 ; H2AFV-008; intron 1
OTTHUMT00000251304 ; H2AFV-001; intron 2
OTTHUMT00000341803 ; H2AFV-005; intron 2
OTTHUMT00000251330 ; H2AFV-004; intron 2
OTTHUMT00000251305 ; H2AFV-002; intron 2
OTTHUMT00000376523 ; H2AFV-007; intron 2
OTTHUMT00000341804 ; H2AFV-006; intron 2
ENST00000350771 ; H2AFV-003; intron 1
ENST00000521529 ; H2AFV-008; intron 1
ENST00000222690 ; H2AFV-001; intron 2
ENST00000437072 ; H2AFV-005; intron 2
ENST00000349299 ; H2AFV-004; intron 2
ENST00000308153 ; H2AFV-002; intron 2
ENST00000381124 ; H2AFV-007; intron 2
ENST00000446531 ; H2AFV-006; intron 2
Database links

Mature sequence hsa-miR-4657

Accession MIMAT0019724
Sequence

1 -  

aauguggaaguggucugaggcau

 - 23

Get sequence
Deep sequencing119 reads, 46 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).