![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4659a |
||||||
Accession | MI0017287 (change log) | |||||
Symbol | HGNC:MIR4659A | |||||
Description | Homo sapiens miR-4659a stem-loop | |||||
Gene family | MIPF0001256; mir-4659 | |||||
Literature search |
1 open access papers mention hsa-mir-4659a | |||||
Stem-loop |
c a c c g 5' gaaacug uga g ugccaugucuaagaagaaaa uuu g ||||||| ||| | |||||||||||||||||||| ||| a 3' cuuugac acu c acgguacagauucuucuuuu aaa g a g a a a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-4659a-5p |
|
Accession | MIMAT0019726 |
Sequence |
14 - cugccaugucuaagaagaaaac - 35 |
Deep sequencing | 27 reads, 15 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4659a-3p |
|
Accession | MIMAT0019727 |
Sequence |
49 - uuucuucuuagacauggcaacg - 70 |
Deep sequencing | 169 reads, 62 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|