Stem-loop sequence hsa-mir-4662a

Accession

MI0017290 (change log)

Symbol

HGNC:MIR4662A

Description

Homo sapiens miR-4662a stem-loop

Gene family

MIPF0001245; mir-4662

Stem-loop

                     c        c   u 
5' ucuauuuagccaauuguc aucuuuag uau c
   |||||||||||||||||| |||||||| ||| u
3' agauaaaucgguuaacag uagaaauc gua g
                     a        c   a 

Deep sequencing

446 reads, 2.27 reads per million, 88 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 124821985-124822051 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000381350 ; FAM91A1-006; intron 1

  OTTHUMT00000381351 ; FAM91A1-008; intron 1

  OTTHUMT00000381352 ; FAM91A1-007; intron 1

  OTTHUMT00000381345 ; FAM91A1-004; intron 22

  OTTHUMT00000256607 ; FAM91A1-001; intron 22

  OTTHUMT00000381347 ; FAM91A1-003; intron 22

  ENST00000518333 ; FAM91A1-006; intron 1

  ENST00000518976 ; FAM91A1-008; intron 1

  ENST00000520246 ; FAM91A1-007; intron 1

  ENST00000521166 ; FAM91A1-004; intron 22

  ENST00000334705 ; FAM91A1-001; intron 22

  ENST00000519721 ; FAM91A1-003; intron 22

Clustered miRNAs

< 10kb from hsa-mir-4662a

• hsa-mir-4662b: chr8: 124821978-124822058 [-]
• hsa-mir-4662a: chr8: 124821985-124822051 [+]

Database links

• EntrezGene:MIR4662A
• HGNC:MIR4662A
• RNAcentral:URS000075B8C2_9606
• miRBase Tracker:MI0017290

Mature sequence hsa-miR-4662a-5p

• Accession: MIMAT0019731
• Sequence: 6 - uuagccaauuguccaucuuuag - 27
• Deep sequencing: 352 reads, 80 experiments
• Evidence: experimental; Illumina [1,3]
• Database links:
  • RNAcentral:URS00005140D0_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4662a-5p
  • TargetScanVert:hsa-miR-4662a-5p
  • miRDB:hsa-miR-4662a-5p

Mature sequence hsa-miR-4662a-3p

• Accession: MIMAT0019732
• Sequence: 43 - aaagauagacaauuggcuaaau - 64
• Deep sequencing: 92 reads, 50 experiments
• Evidence: experimental; Illumina [1,3]
• Predicted targets:
  • TargetMiner:hsa-miR-4662a-3p
  • TargetScanVert:hsa-miR-4662a-3p
  • miRDB:hsa-miR-4662a-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
3. PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).