![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4662a |
||||||
Accession | MI0017290 (change log) | |||||
Symbol | HGNC:MIR4662A | |||||
Description | Homo sapiens miR-4662a stem-loop | |||||
Gene family | MIPF0001245; mir-4662 | |||||
Stem-loop |
c c u 5' ucuauuuagccaauuguc aucuuuag uau c |||||||||||||||||| |||||||| ||| u 3' agauaaaucgguuaacag uagaaauc gua g a c a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-4662a-5p |
|
Accession | MIMAT0019731 |
Sequence |
6 - uuagccaauuguccaucuuuag - 27 |
Deep sequencing | 352 reads, 80 experiments |
Evidence | experimental; Illumina [1,3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-4662a-3p |
|
Accession | MIMAT0019732 |
Sequence |
43 - aaagauagacaauuggcuaaau - 64 |
Deep sequencing | 92 reads, 50 experiments |
Evidence | experimental; Illumina [1,3] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
2 |
PMID:21911355
"miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades"
Nucleic Acids Res. 40:37-52(2012).
|
3 |
PMID:21807764
"Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome"
Hum Mol Genet. 20:4025-4040(2011).
|