![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4659b |
||||||
Accession | MI0017291 (change log) | |||||
Symbol | HGNC:MIR4659B | |||||
Description | Homo sapiens miR-4659b stem-loop | |||||
Gene family | MIPF0001256; mir-4659 | |||||
Stem-loop |
c u 5' cuguuga guugccaugucuaagaagaaaauuuu c ||||||| |||||||||||||||||||||||||| u 3' gacgacu cgacgguacagauucuucuuuugaaa c u c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-4659b-5p |
|
Accession | MIMAT0019733 |
Sequence |
10 - uugccaugucuaagaagaa - 28 |
Deep sequencing | 22 reads, 11 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4659b-3p |
|
Accession | MIMAT0019734 |
Sequence |
45 - uuucuucuuagacauggcagcu - 66 |
Deep sequencing | 158 reads, 57 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|