![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4663 |
|||||
Accession | MI0017292 (change log) | ||||
Symbol | HGNC:MIR4663 | ||||
Description | Homo sapiens miR-4663 stem-loop | ||||
Stem-loop |
ug u ag u -c - a 5' cug g gg cugagcucca gga gu gcaguggc u ||| | || |||||||||| ||| || |||||||| 3' gac u cc gacucgaggu ccu cg cguuacug c gu c -g - uc u u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4663 |
|
Accession | MIMAT0019735 |
Sequence |
10 - agcugagcuccauggacgugcagu - 33 |
Deep sequencing | 10 reads, 6 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|