![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4670 |
|||||
Accession | MI0017301 (change log) | ||||
Symbol | HGNC:MIR4670 | ||||
Description | Homo sapiens miR-4670 stem-loop | ||||
Stem-loop |
ca cu 5' cucuaggaagcgaccaugauguaacuuca gacu c ||||||||||||||||||||||||||||| |||| c 3' gagauccuucgcugguacuacauugaagu cuga a -- aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4670-5p |
|
Accession | MIMAT0019750 |
Sequence |
8 - aagcgaccaugauguaacuuca - 29 |
Deep sequencing | 37 reads, 23 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4670-3p |
|
Accession | MIMAT0019751 |
Sequence |
47 - ugaaguuacaucauggucgcuu - 68 |
Deep sequencing | 51 reads, 29 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|