Stem-loop sequence hsa-mir-4675

AccessionMI0017306 (change log)
Symbol HGNC:MIR4675
DescriptionHomo sapiens miR-4675 stem-loop
Stem-loop 
           a             c           uca 
5' caugagaa uccugcuggucaa cauagcccugg   g
   |||||||| ||||||||||||| |||||||||||   a
3' guacucuu aggacgaccaguu gugucggggcc   c
           c             a           ucu
Get sequence
Deep sequencing
19 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 20551970-20552046 [+]
sense
OTTHUMT00000047102 ; PLXDC2-002; intron 12
OTTHUMT00000047103 ; PLXDC2-003; intron 12
OTTHUMT00000047101 ; PLXDC2-001; intron 13
ENST00000377242 ; PLXDC2-002; intron 12
ENST00000377238 ; PLXDC2-003; intron 12
ENST00000377252 ; PLXDC2-001; intron 13
Database links

Mature sequence hsa-miR-4675

Accession MIMAT0019757
Sequence

46 -  

ggggcugugauugaccagcagg

 - 67

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).