Stem-loop sequence hsa-mir-4677

Accession

MI0017308 (change log)

Symbol

HGNC:MIR4677

Description

Homo sapiens miR-4677 stem-loop

Gene family

MIPF0001848; mir-4677

Stem-loop

     a      caauu             u   c  u  ccu 
5' gc aagcag     guucuuuggucuu cag ca ga   g
   || ||||||     ||||||||||||| ||| || ||    
3' cg uucguu     caagaaaccagag guc gu cu   a
     g      -ucau             u   u  -  ucc 

Deep sequencing

1935 reads, 1.59 reads per million, 126 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 243346176-243346255 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000381212 ; CEP170-025; intron 1

  OTTHUMT00000096196 ; CEP170-008; intron 2

  OTTHUMT00000381167 ; CEP170-022; intron 2

  OTTHUMT00000096179 ; CEP170-004; intron 5

  OTTHUMT00000096176 ; CEP170-001; intron 9

  OTTHUMT00000096177 ; CEP170-002; intron 9

  OTTHUMT00000096178 ; CEP170-003; intron 10

  ENST00000522895 ; CEP170-025; intron 1

  ENST00000461671 ; CEP170-008; intron 2

  ENST00000521911 ; CEP170-022; intron 2

  ENST00000336415 ; CEP170-004; intron 5

  ENST00000366544 ; CEP170-001; intron 9

  ENST00000366543 ; CEP170-002; intron 9

  ENST00000366542 ; CEP170-003; intron 10

Database links

• EntrezGene:MIR4677
• HGNC:MIR4677
• RNAcentral:URS000075ABD7_9606
• miRBase Tracker:MI0017308

Mature sequence hsa-miR-4677-5p

• Accession: MIMAT0019760
• Sequence: 13 - uuguucuuuggucuuucagcca - 34
• Deep sequencing: 225 reads, 54 experiments
• Evidence: experimental; Illumina [1,3]
• Predicted targets:
  • TargetMiner:hsa-miR-4677-5p
  • TargetScanVert:hsa-miR-4677-5p
  • miRDB:hsa-miR-4677-5p

Mature sequence hsa-miR-4677-3p

• Accession: MIMAT0019761
• Sequence: 50 - ucugugagaccaaagaacuacu - 71
• Deep sequencing: 1707 reads, 121 experiments
• Evidence: experimental; Illumina [1,3]
• Database links:
  • RNAcentral:URS0000372130_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4677-3p
  • TargetScanVert:hsa-miR-4677-3p
  • miRDB:hsa-miR-4677-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
3. PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).