Stem-loop sequence hsa-mir-4679-1

Accession

MI0017310 (change log)

Symbol

HGNC:MIR4679-1

Description

Homo sapiens miR-4679-1 stem-loop

Gene family

MIPF0001228; mir-4679

Stem-loop

                                   guua 
5' gucuuuuuucugugauagagauucuuugcuuu    g
   ||||||||||||||||||||||||||||||||    a
3' uagaaaaaagacacuaucucuaagaaacgaaa    a
                                   aaca 

Deep sequencing

131 reads, 4.35 reads per million, 69 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr10: 89063336-89063410 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000049199 ; RP11-322M19.1-001; intron 1

  OTTHUMT00000049203 ; RP11-322M19.1-005; intron 1

  OTTHUMT00000049201 ; RP11-322M19.1-003; intron 2

  OTTHUMT00000049202 ; RP11-322M19.1-004; intron 3

  OTTHUMT00000049209 ; RP11-322M19.1-011; intron 3

  OTTHUMT00000049206 ; RP11-322M19.1-008; intron 3

  OTTHUMT00000049210 ; RP11-322M19.1-012; intron 3

  OTTHUMT00000049204 ; RP11-322M19.1-006; intron 3

  ENST00000456104 ; NUTM2A-AS1-001; intron 1

  ENST00000420424 ; NUTM2A-AS1-005; intron 1

  ENST00000433530 ; NUTM2A-AS1-003; intron 2

  ENST00000451940 ; NUTM2A-AS1-004; intron 3

  ENST00000447424 ; NUTM2A-AS1-011; intron 3

  ENST00000433920 ; NUTM2A-AS1-008; intron 3

  ENST00000446751 ; NUTM2A-AS1-012; intron 3

  ENST00000413722 ; NUTM2A-AS1-006; intron 3

Clustered miRNAs

< 10kb from hsa-mir-4679-1

• hsa-mir-4679-2: chr10: 89063335-89063411 [-]
• hsa-mir-4679-1: chr10: 89063336-89063410 [+]

Database links

• EntrezGene:MIR4679-1
• HGNC:MIR4679-1
• miRBase Tracker:MI0017310

Mature sequence hsa-miR-4679

• Accession: MIMAT0019763
• Sequence: 9 - ucugugauagagauucuuugcu - 30
• Deep sequencing: 236 reads, 63 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4679
  • TargetScanVert:hsa-miR-4679
  • miRDB:hsa-miR-4679

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).