![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4679-2 |
||||||
Accession | MI0017311 (change log) | |||||
Symbol | HGNC:MIR4679-2 | |||||
Description | Homo sapiens miR-4679-2 stem-loop | |||||
Gene family | MIPF0001228; mir-4679 | |||||
Stem-loop |
ua uu u
5' ucuuuuuucugugauagagauucuuugcuu ugu u
|||||||||||||||||||||||||||||| ||| c
3' agaaaaaagacacuaucucuaagaaacgaa aca u
gc -- a
|
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-4679 |
|
Accession | MIMAT0019763 |
Sequence |
10 - ucugugauagagauucuuugcu - 31 |
Deep sequencing | 236 reads, 63 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|