![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4680 |
|||||
Accession | MI0017312 (change log) | ||||
Symbol | HGNC:MIR4680 | ||||
Description | Homo sapiens miR-4680 stem-loop | ||||
Gene family | MIPF0001988; mir-4680 | ||||
Literature search |
1 open access papers mention hsa-mir-4680 | ||||
Stem-loop |
--ua g c u a 5' uaa aacucuugcagu uuagaugu aua a ||| |||||||||||| |||||||| ||| 3' auu uugagaauguua agucuaua uau a cacg g - - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4680-5p |
|
Accession | MIMAT0019764 |
Sequence |
5 - agaacucuugcagucuuagaugu - 27 |
Deep sequencing | 31 reads, 23 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4680-3p |
|
Accession | MIMAT0019765 |
Sequence |
42 - ucugaauuguaagaguuguua - 62 |
Deep sequencing | 35 reads, 24 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|