Stem-loop sequence hsa-mir-4683

AccessionMI0017315 (change log)
Symbol HGNC:MIR4683
DescriptionHomo sapiens miR-4683 stem-loop
Stem-loop 
   gac  gca   -  a       -     gg g       uc 
5'    ac   aga cg ggcgggc cugga  u caccagu  u
      ||   ||| || ||||||| |||||  | |||||||  g
3'    ug   ucu gc ccgcucg gaccu  a guggucg  g
   -cu  aac   a  -       u     ag g       cc
Get sequence
Deep sequencing
201 reads, 1.47 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 35641172-35641252 [-]
antisense
OTTHUMT00000047568 ; CCNY-002; intron 1
OTTHUMT00000047569 ; CCNY-003; intron 1
OTTHUMT00000047567 ; CCNY-001; intron 3
OTTHUMT00000047573 ; CCNY-007; intron 3
OTTHUMT00000047570 ; CCNY-004; intron 6
ENST00000374704 ; CCNY-002; intron 1
ENST00000492478 ; CCNY-003; intron 1
ENST00000339497 ; CCNY-202; intron 1
ENST00000265375 ; CCNY-201; intron 1
ENST00000374706 ; CCNY-001; intron 3
ENST00000493157 ; CCNY-007; intron 3
ENST00000490012 ; CCNY-004; intron 6
Database links

Mature sequence hsa-miR-4683

Accession MIMAT0019768
Sequence

50 -  

uggagauccagugcucgcccgau

 - 72

Get sequence
Deep sequencing155 reads, 61 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).