![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4683 |
|||||
Accession | MI0017315 (change log) | ||||
Symbol | HGNC:MIR4683 | ||||
Description | Homo sapiens miR-4683 stem-loop | ||||
Stem-loop |
gac gca - a - gg g uc 5' ac aga cg ggcgggc cugga u caccagu u || ||| || ||||||| ||||| | ||||||| g 3' ug ucu gc ccgcucg gaccu a guggucg g -cu aac a - u ag g cc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4683 |
|
Accession | MIMAT0019768 |
Sequence |
50 - uggagauccagugcucgcccgau - 72 |
Deep sequencing | 155 reads, 61 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|