![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4686 |
|||||
Accession | MI0017318 (change log) | ||||
Symbol | HGNC:MIR4686 | ||||
Description | Homo sapiens miR-4686 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4686 | ||||
Stem-loop |
cu a ucu gg ag 5' ggcuuc gu ucugcugggcuu gguguu c c |||||| || |||||||||||| |||||| | c 3' ccgaag cg ggacgacccggg ccacag g c ac a -uc ua aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4686 |
|
Accession | MIMAT0019773 |
Sequence |
10 - uaucugcugggcuuucugguguu - 32 |
Deep sequencing | 13 reads, 12 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|