![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4695 |
|||||
Accession | MI0017328 (change log) | ||||
Symbol | HGNC:MIR4695 | ||||
Description | Homo sapiens miR-4695 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-4695 | ||||
Stem-loop |
ccugc gc -- --gg gc 5' aggaggcagugg gag caggc ggca c |||||||||||| ||| ||||| |||| 3' uccuccgucgcc cuc guccg ccgu c -cccu -a ua ggua aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4695-5p |
|
Accession | MIMAT0019788 |
Sequence |
5 - caggaggcagugggcgagcagg - 26 |
Deep sequencing | 24 reads, 19 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4695-3p |
|
Accession | MIMAT0019789 |
Sequence |
51 - ugaucucaccgcugccuccuuc - 72 |
Deep sequencing | 3942 reads, 101 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|