miRBase entry: hsa-mir-4701

Stem-loop hsa-mir-4701


Accession
MI0017334
Symbol
HGNC: MIR4701
Description
Homo sapiens hsa-mir-4701 precursor miRNA

Literature search
1 open access papers mention hsa-mir-4701
(3 sentences)

Sequence

23 reads, 1 reads per million, 9 experiments
ccUUGGCCACCACACCUACCCCUUgugaaugucgggcaAUGGGUGAUGGGUGUGGUGUccaca
...(((.(((((((((((((((((((.........)))).))).).))))))))))).)))..

Structure
ccU   C           - -   -    gaa 
   UGG CACCACACCUA C CCC UUgu   u
   ||| ||||||||||| | ||| ||||   g
   acc GUGGUGUGGGU G GGG Aacg   u
-ac   U           A U   U    ggc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr12: 48771975-48772037 [-]

Disease association
hsa-mir-4701 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4701-5p

Accession MIMAT0019798
Description Homo sapiens hsa-miR-4701-5p mature miRNA
Sequence 3 - UUGGCCACCACACCUACCCCUU - 24
Evidence experimental
Illumina [1]

Mature hsa-miR-4701-3p

Accession MIMAT0019799
Description Homo sapiens hsa-miR-4701-3p mature miRNA
Sequence 39 - AUGGGUGAUGGGUGUGGUGU - 58
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86