![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3198-2 |
|||||
Accession | MI0017335 (change log) | ||||
Symbol | HGNC:MIR3198-2 | ||||
Description | Homo sapiens miR-3198-2 stem-loop | ||||
Gene family | MIPF0001216; mir-3198 | ||||
Literature search |
1 open access papers mention hsa-mir-3198-2 | ||||
Stem-loop |
c a a c -a u a 5' gacu ugcucuc cuguuc cccag acu gcag acc g |||| ||||||| |||||| ||||| ||| |||| ||| 3' cuga acgagag gguaag ggguc uga uguc ugg a c a - c gg u u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3198 |
|
Accession | MIMAT0015083 |
Sequence |
49 - guggaguccuggggaauggaga - 70 |
Deep sequencing | 234 reads, 38 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|