Stem-loop sequence hsa-mir-3198-2

AccessionMI0017335 (change log)
Symbol HGNC:MIR3198-2
DescriptionHomo sapiens miR-3198-2 stem-loop
Gene family MIPF0001216; mir-3198
Literature search

1 open access papers mention hsa-mir-3198-2
(1 sentences)

Stem-loop 
       c       a      a     c   -a    u   a 
5' gacu ugcucuc cuguuc cccag acu  gcag acc g
   |||| ||||||| |||||| ||||| |||  |||| |||  
3' cuga acgagag gguaag ggguc uga  uguc ugg a
       c       a      -     c   gg    u   u
Get sequence
Deep sequencing
134 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 54231397-54231476 [-]
intergenic
Database links

Mature sequence hsa-miR-3198

Accession MIMAT0015083
Sequence

49 -  

guggaguccuggggaauggaga

 - 70

Get sequence
Deep sequencing234 reads, 38 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).