Stem-loop sequence hsa-mir-4706

AccessionMI0017339 (change log)
Symbol HGNC:MIR4706
DescriptionHomo sapiens miR-4706 stem-loop
Stem-loop 
            ag     -    a      -   g     gcg 
5' gcuacgggg  cgggg agga gugggc gcu cuucu   u
   |||||||||  ||||| |||| |||||| ||| |||||   u
3' uggugucuc  guccu uccu cacccg cga gaagg   a
            gg     g    -      a   g     ucu
Get sequence
Deep sequencing
149 reads, 8 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 65044688-65044769 [+]
sense
OTTHUMT00000280667 ; PPP1R36-001; intron 8
OTTHUMT00000280668 ; PPP1R36-002; intron 9
ENST00000298705 ; PPP1R36-001; intron 8
ENST00000467261 ; PPP1R36-002; intron 9
antisense
OTTHUMT00000414203 ; RP11-973N13.3-001; intron 1
OTTHUMT00000414204 ; RP11-973N13.3-002; intron 1
ENST00000556634 ; RP11-973N13.3-001; intron 1
ENST00000554454 ; RP11-973N13.3-002; intron 1
Database links

Mature sequence hsa-miR-4706

Accession MIMAT0019806
Sequence

10 -  

agcggggaggaagugggcgcugcuu

 - 34

Get sequence
Deep sequencing119 reads, 41 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).