![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4706 |
|||||
Accession | MI0017339 (change log) | ||||
Symbol | HGNC:MIR4706 | ||||
Description | Homo sapiens miR-4706 stem-loop | ||||
Stem-loop |
ag - a - g gcg 5' gcuacgggg cgggg agga gugggc gcu cuucu u ||||||||| ||||| |||| |||||| ||| ||||| u 3' uggugucuc guccu uccu cacccg cga gaagg a gg g - a g ucu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4706 |
|
Accession | MIMAT0019806 |
Sequence |
10 - agcggggaggaagugggcgcugcuu - 34 |
Deep sequencing | 119 reads, 41 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|