Stem-loop sequence hsa-mir-4708

Accession

MI0017341 (change log)

Symbol

HGNC:MIR4708

Description

Homo sapiens miR-4708 stem-loop

Literature search

1 open access papers mention hsa-mir-4708
(1 sentences)

Stem-loop

   u    ---g                       ga 
5'  uuag    agagagaugccgccuugcuccuu  a
    ||||    |||||||||||||||||||||||   
3'  aauc    ucucucuacggcggaacgaggag  c
   a    auag                       ga 

Deep sequencing

85 reads, 8.33 reads per million, 36 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr14: 65335117-65335183 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000414076 ; SPTB-001; intron 1

  ENST00000556626 ; SPTB-001; intron 1

  ENST00000542895 ; SPTB-202; intron 1

Database links

• EntrezGene:MIR4708
• HGNC:MIR4708
• RNAcentral:URS000075C230_9606
• miRBase Tracker:MI0017341

Mature sequence hsa-miR-4708-5p

• Accession: MIMAT0019809
• Sequence: 9 - agagaugccgccuugcuccuu - 29
• Deep sequencing: 7 reads, 7 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4708-5p
  • TargetScanVert:hsa-miR-4708-5p
  • miRDB:hsa-miR-4708-5p

Mature sequence hsa-miR-4708-3p

• Accession: MIMAT0019810
• Sequence: 40 - agcaaggcggcaucucucugau - 61
• Deep sequencing: 71 reads, 27 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS00004F4FFB_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4708-3p
  • TargetScanVert:hsa-miR-4708-3p
  • miRDB:hsa-miR-4708-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).