Stem-loop sequence hsa-mir-4709

AccessionMI0017342 (change log)
Symbol HGNC:MIR4709
DescriptionHomo sapiens miR-4709 stem-loop
Literature search

1 open access papers mention hsa-mir-4709
(2 sentences)

Stem-loop 
        ucaaca    u -    g    c      u   c 
5' cugcu      acag g acuu cucu caaugg auc a
   |||||      |||| | |||| |||| |||||| |||  
3' gacga      uguc c ugga gaga guugcu uag g
        ------    u g    g    a      -   u
Get sequence
Deep sequencing
138 reads, 4.05 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 74480133-74480204 [-]
sense
OTTHUMT00000412635 ; ENTPD5-004; intron 1
OTTHUMT00000412637 ; ENTPD5-001; intron 2
OTTHUMT00000412640 ; ENTPD5-008; intron 2
OTTHUMT00000412641 ; ENTPD5-005; intron 2
OTTHUMT00000412642 ; ENTPD5-006; intron 2
OTTHUMT00000412643 ; ENTPD5-003; intron 2
ENST00000557325 ; ENTPD5-004; intron 1
ENST00000334696 ; ENTPD5-001; intron 2
ENST00000556242 ; ENTPD5-008; intron 2
ENST00000554664 ; ENTPD5-005; intron 2
ENST00000556108 ; ENTPD5-006; intron 2
ENST00000557681 ; ENTPD5-003; intron 2
Database links

Mature sequence hsa-miR-4709-5p

Accession MIMAT0019811
Sequence

9 -  

acaacagugacuugcucuccaa

 - 30

Get sequence
Deep sequencing33 reads, 29 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4709-3p

Accession MIMAT0019812
Sequence

48 -  

uugaagaggaggugcucuguagc

 - 70

Get sequence
Deep sequencing102 reads, 55 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).