Stem-loop sequence hsa-mir-203b

Accession

MI0017343 (change log)

Previous IDs

hsa-mir-3545

Symbol

HGNC:MIR203B

Description

Homo sapiens miR-203b stem-loop

Gene family

MIPF0000108; mir-203

Literature search

287 open access papers mention hsa-mir-203b
(2507 sentences)

Stem-loop

       cc  c            c  a    u    -  a  g gc 
5' gcgc  gc gggucuaguggu cu aaca uuca ca uu c  u
   ||||  || |||||||||||| || |||| |||| || || |   
3' cgcg  cg cccaggucacca ga uugu aagu gu aa g  a
       --  a            a  a    c    u  c  - ac 

Deep sequencing

711 reads, 0 reads per million, 73 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr14: 104117418-104117503 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000414859 ; KLC1-021; intron 1

  OTTHUMT00000402947 ; KLC1-001; intron 1

  OTTHUMT00000402944 ; KLC1-003; intron 1

  OTTHUMT00000414860 ; KLC1-022; intron 1

  OTTHUMT00000402945 ; KLC1-002; intron 1

  OTTHUMT00000414861 ; KLC1-009; intron 1

  OTTHUMT00000414862 ; KLC1-008; intron 1

  OTTHUMT00000402946 ; KLC1-005; intron 1

  OTTHUMT00000414863 ; KLC1-016; intron 1

  OTTHUMT00000414864 ; KLC1-010; intron 1

  OTTHUMT00000414866 ; KLC1-011; intron 1

  OTTHUMT00000414867 ; KLC1-013; intron 1

  OTTHUMT00000414868 ; KLC1-020; intron 1

  OTTHUMT00000402950 ; KLC1-004; intron 1

  OTTHUMT00000414869 ; KLC1-017; intron 1

  OTTHUMT00000414871 ; KLC1-015; intron 1

  OTTHUMT00000402943 ; RP11-73M18.2-001; intron 4

  ENST00000557172 ; KLC1-021; intron 1

  ENST00000348520 ; KLC1-001; intron 1

  ENST00000380038 ; KLC1-003; intron 1

  ENST00000555467 ; KLC1-022; intron 1

  ENST00000389744 ; KLC1-002; intron 1

  ENST00000557575 ; KLC1-009; intron 1

  ENST00000553286 ; KLC1-008; intron 1

  ENST00000347839 ; KLC1-005; intron 1

  ENST00000555836 ; KLC1-016; intron 1

  ENST00000334553 ; KLC1-010; intron 1

  ENST00000246489 ; KLC1-011; intron 1

  ENST00000554228 ; KLC1-013; intron 1

  ENST00000557450 ; KLC1-020; intron 1

  ENST00000452929 ; KLC1-004; intron 1

  ENST00000554280 ; KLC1-017; intron 1

  ENST00000445352 ; KLC1-015; intron 1

  ENST00000472726 ; RP11-73M18.2-001; intron 4

Clustered miRNAs

< 10kb from hsa-mir-203b

• hsa-mir-203b: chr14: 104117418-104117503 [-]
• hsa-mir-203a: chr14: 104117405-104117514 [+]

Database links

• EntrezGene:MIR3545
• HGNC:MIR203B
• miRBase Tracker:MI0017343

Mature sequence hsa-miR-203b-5p

• Accession: MIMAT0019813
• Previous IDs: hsa-miR-3545-5p
• Sequence: 15 - uagugguccuaaacauuucaca - 36
• Deep sequencing: 56 reads, 16 experiments
• Evidence: experimental; Illumina [1-2]
• Predicted targets:
  • TargetScanVert:hsa-miR-203b-5p
  • miRDB:hsa-miR-203b-5p

Mature sequence hsa-miR-203b-3p

• Accession: MIMAT0019814
• Previous IDs: hsa-miR-3545-3p
• Sequence: 54 - uugaacuguuaagaaccacugga - 76
• Deep sequencing: 649 reads, 68 experiments
• Evidence: experimental; Illumina [1-2]
• Predicted targets:
  • TargetScanVert:hsa-miR-203b-3p
  • miRDB:hsa-miR-203b-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).