miRBase entry: hsa-mir-4714

Stem-loop hsa-mir-4714


Accession
MI0017348
Symbol
HGNC: MIR4714
Description
Homo sapiens hsa-mir-4714 precursor miRNA

Literature search
0 open access papers mention hsa-mir-4714
(0 sentences)

Sequence

48 reads, 1 reads per million, 19 experiments
auuuuggccAACUCUGACCCCUUAGGUUGAUgucagaaugagguguaCCAACCUAGGUGGUCAGAGUUGgccaaaau
(((((((((((((((((((.(((((((((((.(((...))).))....))))))))).)))))))))))))))))))

Structure
                   C         ----  g   g 
auuuuggccAACUCUGACC CUUAGGUUG    AU uca  
||||||||||||||||||| |||||||||    || ||| a
uaaaaccgGUUGAGACUGG GGAUCCAAC    ug agu  
                   U         Caug  g   a 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr15: 98784426-98784502 [+]

Disease association
hsa-mir-4714 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4714-5p

Accession MIMAT0019822
Description Homo sapiens hsa-miR-4714-5p mature miRNA
Sequence 10 - AACUCUGACCCCUUAGGUUGAU - 31
Evidence experimental
Illumina [1]

Mature hsa-miR-4714-3p

Accession MIMAT0019823
Description Homo sapiens hsa-miR-4714-3p mature miRNA
Sequence 48 - CCAACCUAGGUGGUCAGAGUUG - 69
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86