Stem-loop sequence hsa-mir-4721

AccessionMI0017356 (change log)
Symbol HGNC:MIR4721
DescriptionHomo sapiens miR-4721 stem-loop
Literature search

3 open access papers mention hsa-mir-4721
(5 sentences)

Stem-loop 
   ggg    g    g    agcca     -    -aa   -     a 
5'    ccug ucau guca     gguuc cauc   gcc ccacc g
      |||| |||| ||||     ||||| ||||   ||| |||||  
3'    ggac ggug cagu     ucggg gugg   cgg ggugg a
   uug    g    g    ggacc     a    acc   a     a
Get sequence
Deep sequencing
37 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 28843919-28844007 [-]
sense
OTTHUMT00000432661 ; RP11-24N18.1-001; intron 1
ENST00000563565 ; RP11-24N18.1-001; intron 1
antisense
OTTHUMT00000432051 ; ATXN2L-007; intron 6
OTTHUMT00000432645 ; ATXN2L-012; intron 12
OTTHUMT00000214137 ; ATXN2L-001; intron 12
OTTHUMT00000431011 ; ATXN2L-005; intron 12
OTTHUMT00000214138 ; ATXN2L-002; intron 12
OTTHUMT00000214139 ; ATXN2L-003; intron 12
OTTHUMT00000431012 ; ATXN2L-004; intron 12
OTTHUMT00000432048 ; ATXN2L-008; intron 12
OTTHUMT00000432049 ; ATXN2L-006; intron 12
ENST00000565971 ; ATXN2L-007; intron 6
ENST00000563314 ; ATXN2L-012; intron 12
ENST00000340394 ; ATXN2L-001; intron 12
ENST00000325215 ; ATXN2L-005; intron 12
ENST00000395547 ; ATXN2L-002; intron 12
ENST00000336783 ; ATXN2L-003; intron 12
ENST00000382686 ; ATXN2L-004; intron 12
ENST00000564304 ; ATXN2L-008; intron 12
ENST00000570200 ; ATXN2L-006; intron 12
Database links

Mature sequence hsa-miR-4721

Accession MIMAT0019835
Sequence

60 -  

ugagggcuccaggugacggugg

 - 81

Get sequence
Deep sequencing18 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).