Stem-loop sequence hsa-mir-4722

Accession

MI0017357 (change log)

Symbol

HGNC:MIR4722

Description

Homo sapiens miR-4722 stem-loop

Stem-loop

   -g     -   -    u  c     -    gg 
5'   gcagg agg gcug gc agguu ggcu  g
     ||||| ||| |||| || ||||| ||||   
3'   cgucc ucc cgac cg uccag ccgg  c
   ga     c   a    -  -     u    ac 

Deep sequencing

52 reads, 12 reads per million, 25 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr16: 88716278-88716337 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000422765 ; CYBA-001; intron 1

  OTTHUMT00000422768 ; CYBA-009; intron 1

  OTTHUMT00000422770 ; CYBA-011; intron 1

  OTTHUMT00000422771 ; CYBA-005; intron 1

  OTTHUMT00000422772 ; CYBA-003; intron 1

  OTTHUMT00000422773 ; CYBA-004; intron 1

  OTTHUMT00000422774 ; CYBA-006; intron 1

  OTTHUMT00000422775 ; CYBA-010; intron 1

  OTTHUMT00000422776 ; CYBA-007; intron 1

  ENST00000261623 ; CYBA-001; intron 1

  ENST00000566534 ; CYBA-009; intron 1

  ENST00000566229 ; CYBA-011; intron 1

  ENST00000567174 ; CYBA-005; intron 1

  ENST00000569359 ; CYBA-003; intron 1

  ENST00000563526 ; CYBA-004; intron 1

  ENST00000568278 ; CYBA-006; intron 1

  ENST00000562209 ; CYBA-010; intron 1

  ENST00000561972 ; CYBA-007; intron 1

Database links

• EntrezGene:MIR4722
• HGNC:MIR4722
• miRBase Tracker:MI0017357

Mature sequence hsa-miR-4722-5p

• Accession: MIMAT0019836
• Sequence: 1 - ggcaggagggcugugccagguug - 23
• Deep sequencing: 41 reads, 19 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4722-5p
  • TargetScanVert:hsa-miR-4722-5p
  • miRDB:hsa-miR-4722-5p

Mature sequence hsa-miR-4722-3p

• Accession: MIMAT0019837
• Sequence: 39 - accugccagcaccucccugcag - 60
• Deep sequencing: 4 reads, 3 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4722-3p
  • TargetScanVert:hsa-miR-4722-3p
  • miRDB:hsa-miR-4722-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).