![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-451b |
||||||||||
Accession | MI0017360 (change log) | |||||||||
Symbol | HGNC:MIR451B | |||||||||
Description | Homo sapiens miR-451b stem-loop | |||||||||
Gene family | MIPF0000148; mir-451 | |||||||||
Literature search |
![]()
242 open access papers mention hsa-mir-451b | |||||||||
Stem-loop |
u u a ag a aa 5' ggg au gcaag aacc uuaccauuacu a ||| || ||||| |||| ||||||||||| 3' ccc ua cguuc uugg aaugguaauga c a u c cu c cu |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence hsa-miR-451b |
|
Accession | MIMAT0019840 |
Sequence |
7 - uagcaagagaaccauuaccauu - 28 |
Deep sequencing | 715 reads, 26 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|