![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4727 |
|||||
Accession | MI0017364 (change log) | ||||
Symbol | HGNC:MIR4727 | ||||
Description | Homo sapiens miR-4727 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-4727 | ||||
Stem-loop |
- - a cag 5' aaucugccagcuucc ac gugg a ||||||||||||||| || |||| u 3' uuagacggucgaagg ug uacc u c g a cuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4727-5p |
|
Accession | MIMAT0019847 |
Sequence |
2 - aucugccagcuuccacagugg - 22 |
Deep sequencing | 4 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4727-3p |
|
Accession | MIMAT0019848 |
Sequence |
34 - auagugggaagcuggcagauuc - 55 |
Deep sequencing | 121 reads, 39 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|