![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4730 |
|||||
Accession | MI0017367 (change log) | ||||
Symbol | HGNC:MIR4730 | ||||
Description | Homo sapiens miR-4730 stem-loop | ||||
Stem-loop |
-cg c c g c u u ga 5' caggccu ugg g agc cau cca gcca ugcu ||||||| ||| | ||| ||| ||| |||| ||| g 3' guccgga acc c ucg gug ggu cggu gcga gug c u g u u - -a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4730 |
|
Accession | MIMAT0019852 |
Sequence |
10 - cuggcggagcccauuccaugcca - 32 |
Deep sequencing | 30 reads, 20 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|