Stem-loop sequence hsa-mir-4735

Accession

MI0017372 (change log)

Symbol

HGNC:MIR4735

Description

Homo sapiens miR-4735 stem-loop

Literature search

1 open access papers mention hsa-mir-4735
(3 sentences)

Stem-loop

   u      c         a      c      ca 
5'  gcagug cuaauuuga caccuu gguauu  u
    |||||| ||||||||| |||||| ||||||  c
3'  cguuac gauuaaacu guggaa ccauaa  a
   a      a         c      a      aa 

Deep sequencing

90 reads, 75 reads per million, 20 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 196582413-196582481 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR4735
• HGNC:MIR4735
• miRBase Tracker:MI0017372

Mature sequence hsa-miR-4735-5p

• Accession: MIMAT0019860
• Sequence: 8 - ccuaauuugaacaccuucggua - 29
• Deep sequencing: 17 reads, 12 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4735-5p
  • TargetScanVert:hsa-miR-4735-5p
  • miRDB:hsa-miR-4735-5p

Mature sequence hsa-miR-4735-3p

• Accession: MIMAT0019861
• Sequence: 45 - aaaggugcucaaauuagacau - 65
• Deep sequencing: 71 reads, 10 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4735-3p
  • TargetScanVert:hsa-miR-4735-3p
  • miRDB:hsa-miR-4735-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).