Stem-loop sequence hsa-mir-4738

Accession

MI0017376 (change log)

Symbol

HGNC:MIR4738

Description

Homo sapiens miR-4738 stem-loop

Gene family

MIPF0001521; mir-4738

Literature search

1 open access papers mention hsa-mir-4738
(2 sentences)

Stem-loop

       g a        ucuua    c      u         a    a 
5' gguc c uuucuccu     ccag gcguuu caguuucau ggga g
   |||| | ||||||||     |||| |||||| ||||||||| |||| c
3' ccgg g gaagagga     gguc cgcgag gucaaagua ccuu c
       - -        -----    -      -         -    u 

Deep sequencing

182 reads, 3.51 reads per million, 57 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 75784521-75784607 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR4738
• HGNC:MIR4738
• miRBase Tracker:MI0017376

Mature sequence hsa-miR-4738-5p

• Accession: MIMAT0019866
• Sequence: 20 - accagcgcguuuucaguuucau - 41
• Deep sequencing: 3 reads, 3 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4738-5p
  • TargetScanVert:hsa-miR-4738-5p
  • miRDB:hsa-miR-4738-5p

Mature sequence hsa-miR-4738-3p

• Accession: MIMAT0019867
• Sequence: 57 - ugaaacuggagcgccuggagga - 78
• Deep sequencing: 149 reads, 47 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4738-3p
  • TargetScanVert:hsa-miR-4738-3p
  • miRDB:hsa-miR-4738-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).