![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4741 |
|||||
Accession | MI0017379 (change log) | ||||
Symbol | HGNC:MIR4741 | ||||
Description | Homo sapiens miR-4741 stem-loop | ||||
Literature search |
4 open access papers mention hsa-mir-4741 | ||||
Stem-loop |
gcg cg u g --- --------- ca 5' cgg ggg gg ccggcc ccuccg agccc ggccgg g ||| ||| || |||||| |||||| ||||| |||||| 3' gcc ccc uc ggcugg ggaggc ucggg ccggcc c --a uu - - cug cgcgaaauu cc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4741 |
|
Accession | MIMAT0019871 |
Sequence |
59 - cgggcuguccggaggggucggcu - 81 |
Deep sequencing | 846 reads, 55 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|