Stem-loop sequence hsa-mir-122b

AccessionMI0017383 (change log)
Symbol HGNC:MIR3591
DescriptionHomo sapiens miR-122b stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
      u    auuu             c     auagu 
5' cag agcu    agugugauaaugg guuug     u
   ||| ||||    ||||||||||||| |||||      
3' guc ucga    ucacacuguuacc caaac     u
      -    cacc             a     acaga 
Get sequence
Deep sequencing
11866 reads, 136 reads per million, 22 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 58451080-58451152 [-]
sense
OTTHUMT00000449086 ; RP11-325K19.1-001; intron 3
ENST00000591869 ; RP11-325K19.1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-122b
hsa-mir-122bchr18: 58451080-58451152 [-]
hsa-mir-122chr18: 58451074-58451158 [+]
Database links

Mature sequence hsa-miR-122b-5p

Accession MIMAT0019876
Sequence

10 - 

uuuagugugauaauggcguuuga

 - 32

Get sequence
Deep sequencing9278 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-122b-3p

Accession MIMAT0019877
Sequence

45 - 

aaacaccauugucacacuccac

 - 66

Get sequence
Deep sequencing2587 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).