![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4746 |
|||||
Accession | MI0017385 (change log) | ||||
Symbol | HGNC:MIR4746 | ||||
Description | Homo sapiens miR-4746 stem-loop | ||||
Literature search |
![]()
2 open access papers mention hsa-mir-4746 | ||||
Stem-loop |
ucu c - a u aga a 5' gug gug cggucc caggag acc gc ggc u ||| ||| |||||| |||||| ||| || ||| c 3' cac cac gccggg guccuc ugg cg cug g --u a c g - --a g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4746-5p |
|
Accession | MIMAT0019880 |
Sequence |
10 - ccggucccaggagaaccugcaga - 32 |
Deep sequencing | 468 reads, 55 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-4746-3p |
|
Accession | MIMAT0019881 |
Sequence |
44 - agcggugcuccugcgggccga - 64 |
Deep sequencing | 45 reads, 9 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|