Stem-loop sequence hsa-mir-4747

AccessionMI0017386 (change log)
Symbol HGNC:MIR4747
DescriptionHomo sapiens miR-4747 stem-loop
Stem-loop 
   -a    a          -      - a 
5'   ggga ggaggcuugg ucuuag c c
     |||| |||||||||| |||||| | g
3'   cccu cuuucgggcc ggaauc g g
   ga    c          c      u g
Get sequence
Deep sequencing
88 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 4932687-4932740 [+]
sense
OTTHUMT00000450446 ; UHRF1-002; intron 1
OTTHUMT00000450448 ; UHRF1-003; intron 3
OTTHUMT00000450444 ; UHRF1-006; intron 4
OTTHUMT00000450445 ; UHRF1-001; intron 4
OTTHUMT00000450447 ; UHRF1-005; intron 4
OTTHUMT00000450449 ; UHRF1-004; intron 4
ENST00000587870 ; UHRF1-002; intron 1
ENST00000584057 ; MIR4747-201; exon 1
ENST00000591699 ; UHRF1-003; intron 3
ENST00000398240 ; UHRF1-202; intron 3
ENST00000592666 ; UHRF1-006; intron 4
ENST00000591733 ; UHRF1-001; intron 4
ENST00000587187 ; UHRF1-005; intron 4
ENST00000592200 ; UHRF1-004; intron 4
ENST00000262952 ; UHRF1-201; intron 4
ENST00000543616 ; UHRF1-203; intron 4
Database links

Mature sequence hsa-miR-4747-5p

Accession MIMAT0019882
Sequence

1 -  

agggaaggaggcuuggucuuag

 - 22

Get sequence
Deep sequencing51 reads, 29 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4747-3p

Accession MIMAT0019883
Sequence

33 -  

aaggcccgggcuuuccucccag

 - 54

Get sequence
Deep sequencing37 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).