Stem-loop sequence hsa-mir-4748

AccessionMI0017387 (change log)
Symbol HGNC:MIR4748
DescriptionHomo sapiens miR-4748 stem-loop
Stem-loop 
   u    -------   -  a  u     g   a      gg g  a 
5'  ggcu       ggc ug gg uuggg agg uuugcu  u cu g
    ||||       ||| || || ||||| ||| ||||||  | ||  
3'  ccga       ccg ac cc aaccc ucc agacga  a ga a
   a    caucauc   c  -  c     a   c      -a g  g
Get sequence
Deep sequencing
61 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 10780254-10780335 [+]
sense
OTTHUMT00000452059 ; ILF3-008; intron 1
OTTHUMT00000452060 ; ILF3-001; intron 1
OTTHUMT00000452062 ; ILF3-002; intron 1
OTTHUMT00000452065 ; ILF3-015; intron 1
OTTHUMT00000452066 ; ILF3-014; intron 1
OTTHUMT00000452067 ; ILF3-013; intron 1
OTTHUMT00000452064 ; ILF3-016; intron 2
ENST00000587928 ; ILF3-008; intron 1
ENST00000407004 ; ILF3-001; intron 1
ENST00000589998 ; ILF3-002; intron 1
ENST00000589283 ; ILF3-015; intron 1
ENST00000590009 ; ILF3-014; intron 1
ENST00000593199 ; ILF3-013; intron 1
ENST00000449870 ; ILF3-203; intron 1
ENST00000318511 ; ILF3-201; intron 1
ENST00000420083 ; ILF3-202; intron 1
ENST00000589600 ; ILF3-016; intron 2
Database links

Mature sequence hsa-miR-4748

Accession MIMAT0019884
Sequence

10 -  

gagguuuggggaggauuugcu

 - 30

Get sequence
Deep sequencing53 reads, 30 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).