MIR4749 is a type of microRNA that was studied in the context of its interaction with human serum albumin (HSA). The researchers selected complexes with a DDA (donor-donor acceptor) distance falling in the 3.9–4.9 nm interval, taking into account the calculated DDA distance in the 3.8–4.8 nm interval and an estimated contribution of 0.1 nm from the dye attached to the 5′ end of MIR4749 [PMC8835948]. The interaction between HSA and MIR4749 was initially investigated using fluorescence spectroscopy [PMC8835948].
c C A CCA A uag u cUG GGGG CAGG GGGC UC gcug g ||| |||| |||| |||| || |||| GAC CCCC GUCC CCCG ag ugac c - A C -UC C --- a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0019885 |
Description | Homo sapiens hsa-miR-4749-5p mature miRNA |
Sequence | 3 - UGCGGGGACAGGCCAGGGCAUC - 24 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
Accession | MIMAT0019886 |
Description | Homo sapiens hsa-miR-4749-3p mature miRNA |
Sequence | 42 - CGCCCCUCCUGCCCCCACAG - 61 |
Evidence |
experimental
Illumina [1] |
|