Stem-loop sequence hsa-mir-4755

Accession

MI0017395 (change log)

Symbol

HGNC:MIR4755

Description

Homo sapiens miR-4755 stem-loop

Literature search

1 open access papers mention hsa-mir-4755
(1 sentences)

Stem-loop

                                  g ca 
5' agauucagcuuucccuucagagccuggcuuu g  u
   ||||||||||||||||||||||||||||||| |   
3' ucuaaguugaaagggaagucucggaccgaaa u  c
                                  g au 

Deep sequencing

359 reads, 0 reads per million, 92 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr20: 34049119-34049190 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000354652 ; CEP250-013; intron 2

  OTTHUMT00000125974 ; CEP250-002; intron 3

  OTTHUMT00000125975 ; CEP250-003; intron 3

  OTTHUMT00000315969 ; CEP250-007; intron 3

  OTTHUMT00000078877 ; CEP250-001; intron 3

  OTTHUMT00000156149 ; CEP250-006; intron 3

  ENST00000461386 ; CEP250-013; intron 2

  ENST00000446710 ; CEP250-002; intron 3

  ENST00000420564 ; CEP250-003; intron 3

  ENST00000476146 ; CEP250-007; intron 3

  ENST00000397527 ; CEP250-001; intron 3

  ENST00000397524 ; CEP250-006; intron 3

  ENST00000342580 ; CEP250-201; intron 3

Database links

• EntrezGene:MIR4755
• HGNC:MIR4755
• RNAcentral:URS000075DBCD_9606
• miRBase Tracker:MI0017395

Mature sequence hsa-miR-4755-5p

• Accession: MIMAT0019895
• Sequence: 10 - uuucccuucagagccuggcuuu - 31
• Deep sequencing: 67 reads, 29 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000429226_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4755-5p
  • TargetScanVert:hsa-miR-4755-5p
  • miRDB:hsa-miR-4755-5p

Mature sequence hsa-miR-4755-3p

• Accession: MIMAT0019896
• Sequence: 44 - agccaggcucugaagggaaagu - 65
• Deep sequencing: 64 reads, 37 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4755-3p
  • TargetScanVert:hsa-miR-4755-3p
  • miRDB:hsa-miR-4755-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2. PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).