![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-499b |
||||||
Accession | MI0017396 (change log) | |||||
Previous IDs | hsa-mir-499a | |||||
Symbol | HGNC:MIR499B | |||||
Description | Homo sapiens miR-499b stem-loop | |||||
Literature search |
![]()
122 open access papers mention hsa-mir-499b | |||||
Stem-loop |
ggaa a ---ac u -c gugg 5' gc gc agacuugc gugauguu ac a || || |||||||| |||||||| || 3' cg cg ucugaacg cacuacaa ug g ---c c acaau u au agga |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-499b-5p |
|
Accession | MIMAT0019897 |
Previous IDs | hsa-miR-499a-5p |
Sequence |
10 - acagacuugcugugauguuca - 30 |
Deep sequencing | 91 reads, 27 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-499b-3p |
|
Accession | MIMAT0019898 |
Previous IDs | hsa-miR-499a-3p |
Sequence |
46 - aacaucacugcaagucuuaaca - 67 |
Deep sequencing | 327 reads, 10 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|