![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4757 |
|||||
Accession | MI0017398 (change log) | ||||
Symbol | HGNC:MIR4757 | ||||
Description | Homo sapiens miR-4757 stem-loop | ||||
Stem-loop |
-uucc c c g gc 5' agc cgaggccucugugacguca ggu ucu g ||| ||||||||||||||||||| ||| ||| 3' ucg gcuucggagacacugcagu cca agg g gaguc c a g ag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4757-5p |
|
Accession | MIMAT0019901 |
Sequence |
11 - aggccucugugacgucacggugu - 33 |
Deep sequencing | 50 reads, 36 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4757-3p |
|
Accession | MIMAT0019902 |
Sequence |
48 - caugacgucacagaggcuucgc - 69 |
Deep sequencing | 52 reads, 36 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|