Stem-loop sequence hsa-mir-4757

Accession

MI0017398 (change log)

Symbol

HGNC:MIR4757

Description

Homo sapiens miR-4757 stem-loop

Stem-loop

   -uucc   c                   c   g   gc 
5'      agc cgaggccucugugacguca ggu ucu  g
        ||| ||||||||||||||||||| ||| |||   
3'      ucg gcuucggagacacugcagu cca agg  g
   gaguc   c                   a   g   ag 

Deep sequencing

104 reads, 0 reads per million, 56 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 19348429-19348505 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000323832 ; AC092594.1-002; intron 1

  OTTHUMT00000323837 ; AC092594.1-004; intron 1

  OTTHUMT00000323836 ; AC092594.1-003; intron 1

  ENST00000432142 ; AC092594.1-002; intron 1

  ENST00000418165 ; AC092594.1-004; intron 1

  ENST00000449124 ; AC092594.1-003; intron 1

Database links

• EntrezGene:MIR4757
• HGNC:MIR4757
• miRBase Tracker:MI0017398

Mature sequence hsa-miR-4757-5p

• Accession: MIMAT0019901
• Sequence: 11 - aggccucugugacgucacggugu - 33
• Deep sequencing: 50 reads, 36 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4757-5p
  • TargetScanVert:hsa-miR-4757-5p
  • miRDB:hsa-miR-4757-5p

Mature sequence hsa-miR-4757-3p

• Accession: MIMAT0019902
• Sequence: 48 - caugacgucacagaggcuucgc - 69
• Deep sequencing: 52 reads, 36 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4757-3p
  • TargetScanVert:hsa-miR-4757-3p
  • miRDB:hsa-miR-4757-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).