![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4758 |
|||||
Accession | MI0017399 (change log) | ||||
Symbol | HGNC:MIR4758 | ||||
Description | Homo sapiens miR-4758 stem-loop | ||||
Stem-loop |
-- u a -g c ugg -aa c 5' gg g gugg agc gguggggc agu ggg a || | |||| ||| |||||||| ||| ||| 3' cc c cacc ucg ccaccccg ucg ccc c cc u c ag u --- ggg g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4758-5p |
|
Accession | MIMAT0019903 |
Sequence |
2 - gugagugggagccgguggggcug - 24 |
Deep sequencing | 38 reads, 22 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4758-3p |
|
Accession | MIMAT0019904 |
Sequence |
46 - ugccccaccugcugaccacccuc - 68 |
Deep sequencing | 25 reads, 17 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|