Stem-loop sequence hsa-mir-4758

AccessionMI0017399 (change log)
Symbol HGNC:MIR4758
DescriptionHomo sapiens miR-4758 stem-loop
Stem-loop 
   --  u a    -g   c        ugg   -aa   c 
5'   gg g gugg  agc gguggggc   agu   ggg a
     || | ||||  ||| ||||||||   |||   |||  
3'   cc c cacc  ucg ccaccccg   ucg   ccc c
   cc  u c    ag   u        ---   ggg   g
Get sequence
Deep sequencing
73 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 62332487-62332557 [-]
sense
OTTHUMT00000080185 ; ARFRP1-003; intron 1
OTTHUMT00000472027 ; ARFRP1-006; intron 2
OTTHUMT00000472024 ; ARFRP1-007; intron 5
OTTHUMT00000472026 ; ARFRP1-008; intron 5
OTTHUMT00000472029 ; ARFRP1-010; intron 5
OTTHUMT00000080183 ; ARFRP1-001; intron 6
OTTHUMT00000472025 ; ARFRP1-005; intron 6
ENST00000217224 ; ARFRP1-003; intron 1
ENST00000609243 ; ARFRP1-006; intron 2
ENST00000359715 ; ARFRP1-007; intron 5
ENST00000610136 ; ARFRP1-008; intron 5
ENST00000607873 ; ARFRP1-010; intron 5
ENST00000324228 ; ARFRP1-001; intron 6
ENST00000609142 ; ARFRP1-005; intron 6
ENST00000440854 ; ARFRP1-201; intron 6
Database links

Mature sequence hsa-miR-4758-5p

Accession MIMAT0019903
Sequence

2 -  

gugagugggagccgguggggcug

 - 24

Get sequence
Deep sequencing38 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4758-3p

Accession MIMAT0019904
Sequence

46 -  

ugccccaccugcugaccacccuc

 - 68

Get sequence
Deep sequencing25 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).